Coronavirus Covid-19, un complejo puzle.

 CORONOVIRUS COVID-19, UN COMPLEJO PUZZLE

En el año 1977, Jean y Peter Medawar definieron a los virus como un «trozo de malas noticias» envueltas en proteínas. [Peter Brian Medawar ex aequo Frank Macfarlane Burnet recibieron el Premio Nobel de Fisiología o Medicina en el año 1960 en reconocimiento a sus investigaciones sobre la tolerancia inmunológica].

Durante los diez primeros días de este año [2020], dos grupos de investigación shanghanianos descifraron el genoma del virus SARS-Covid-19. A tal fin, usaron una muestra procedente de un hombre infectado en el mercado de marisco de la ciudad china de Wuhan, origen de la actual pandemia.


Los virus son parásitos intracelulares. Cuando un virus penetra en una célula, su genoma (ADN o ARN) se inserta en el genoma, muchísimo mayor, de la célula. Considérese que el genoma del  coronavirus SARS-Covid-19 está formado solo por 30.000 nucleótidos, mientras el genoma humano tiene aproximadamente 3.000 millones (3x109) de nucleótidos.

La investigación ha descubierto los genes del coronavirus Covid-19 que codifican la síntesis de 29 proteínas (puede haber más), con funciones tan diversas como catalizar la fotocopia del genoma vírico (para la producción de copias del virus) hasta inhibir la respuesta inmune del hospedador.

La primera parte de la secuencia del genoma vírico es la siguiente:

auuaaagguuuauaccuucccagguaacaaaccaaccaacuuucgaucucuuguagaucuguucucuaaacgaacuuuaaaaucuguguggcugucacucggcugcaugcuuagugcacucacgcaguauaauuaauaacuaauuacugucguugacaggacacgaguaacucgucuaucuucugcaggcugcuuacgguuucguccguguugcagccgaucaucagcacaucuagguuucguccgggugugaccgaaagguaag…

Cada letra es un nucleótido:

a: adenina; u: uracilo: g: guanina; c: citosina. La información está codificada en la secuencia de letras (nucleótidos).

Una vez infectada, toda la maquinaria celular se pone a trabajar al servicio del virus, traduciendo esa secuencia de letras (nucleótidos) en proteínas víricas.

Tras la inserción del genoma vírico en el genoma de la célula infectada, la primera proteína del virus que se sintetiza es una larga cadena poli-peptídica que, tras ulterior hidrólisis, da lugar a 16 proteínas independientes. Este clivaje es catalizado por otras enzimas víricas que actúan cual tijeras moleculares cortando los enlaces peptídicos en los lugares precisos.

PROTEÍNA NSP1 (proteína saboteadora celular)


Esta proteína (NSP1) ralentiza la síntesis de las proteínas propias de la célula infectada, incluidas algunas (interferón) que podrían luchar contra el virus invasor. Por ello los científicos se refieren a esta proteína vírica como proteína saboteadora.

[NSP, acrónimo en inglés de Non-Structural Protein]


PROTEÍNA NSP2 (proteína misteriosa)




Se desconoce la función de la proteína NSP2. Según algunos modelos la proteína NSP2 está implicada en la organización de los endosomas (corpúsculos sub-celulares) de la célula infectada. Es, pues, una “proteína misteriosa”.




PROTEÍNA NSP3 (proteína que destraba y corta)

NSP3 es una proteína de gran tamaño (elevado peso molecular) con dos funciones trascendentes. Actúa como un supervisor que distribuye las tareas de las demás proteínas virales; e inutiliza proteínas celulares que podrían entorpecer la función de las proteínas víricas.

De manera usual una célula etiqueta las proteínas que hay que eliminar en su propia fábrica de desguace celular. NSP3 bloquea este proceso celular que podría dirigirse a eliminar las proteínas víricas por su condición de extrañas.

PROTEÍNA NSP4





Junto a otras proteínas, NSP4 contribuye a formar burbujas intracelulares donde se ensamblan las nuevas partículas víricas (viriones).





PROTEÍNA NSP5 (proteína tijera)




Como se infiere de su denominación, esta proteína actúa a modo de modista que corta otras proteínas víricas para prevenir (y/o corregir) posibles errores de diseño durante su síntesis.




PROTEÍNA NSP6


Actúa en coordinación con las proteínas NSP3 y NSP4 en la formación de burbujas celulares donde se ensamblan los nuevos viriones (partículas víricas).





PROTEÍNAS NSP7 y NSP8


NSP7 y NSP8 ayudan a otra trascendente proteína (NSP12) en la replicación del ARN vírico, proceso que precisa de una retro-transcripción (ARN vírico  ® ADN vírico), posterior inserción en el genoma de la célula, seguida de la transcripción y traducción usando las enzimas y ribosomas de la propia célula infectada.



PROTEÍNA NSP9 (proteína en el núcleo reactor de la célula)



Esta proteína se infiltra en diminutos canales de la membrana del núcleo celular. ¿Influye en el transporte de moléculas hacia el núcleo, y desde éste al citosol? Se ignora.




PROTEÍNA NSP10 (camuflaje genético)


La proteína vírica NSP10, conjuntamente con NSP16, camuflan a las proteínas víricas evitando su destrucción por las proteínas antivirales que se hallan en todas las células humanas.




PROTEÍNA NSP12 (proteína fotocopiadora)


NSP12 ensambla letras (nucleótidos) en nuevos genomas de virus en formación. Un medicamento, Remdesivir, de Gilead Sciences, interfiere la función de la proteína NSP12 en diversos coronavirus, razón por la que se está usando en la actual pandemia por SARS-Covid-19.

Se ha identificado otra proteína (NSP11) a la que se le supone una función relacionada con la proteína NSP12.







Wang Chen, en primer plano, presidente de la Academia de Ciencias Médicas chinas, anunciando en la ciudad de Wuhan el inicio de un ensayo clínico con el fármaco Remdesivir, entregado gratuitamente por el laboratorio Gilead Sciences.





PROTEÍNA NSP13 (proteína que desenrolla el ARN vírico)





NSP13 es una proteína que desenrolla en ARN. Se encuadra en un grupo de proteínas ubicuas involucradas en la topología de los ácidos nucleicos.







PROTEÍNA NSP14 (proteína lector de pruebas)



Durante la duplicación del ARN vírico (al igual que se produce durante la replicación de ADN de cualquier especie, humanos incluidos) se producen errores. Un conjunto de proteínas se encargan de corregirlos, a la manera de los correctores de estilo que antaño existían en todas las publicaciones escritas. NSP14 es el corrector de estilo de la replicación del genoma de coronavirus SARS-Covid-19.


PROTEÍNA NSP15 (proteína limpiadora)




Esta proteína elimina fragmentos del ARN vírico como estrategia de elusión frente a las defensas de la célula infectada.






PROTEÍNA NSP16 (otra proteína de camuflaje)




NSP16, en conjunción con NSP10 (ver antes en este mismo texto) actúan como proteínas de camuflaje frente a las defensas de la célula infectada.






PROTEÍNA S (de “spike”, espiga)

La proteína S es una de las cuatro proteínas estructurales del coronavirus SARS-Covid-19, siendo las otras tres: E, M y N).

Estas cuatro proteínas estructurales forman la envoltura del coronavirus. Protegen a la molécula de ácido ribonucleico (ARN), el verdadero tesoro que el virus ha de proteger para su perpetuación.

Las proteínas estructurales ayudan al ensamblaje y liberación de las nuevas partículas virales formadas.


Las proteínas S (de “spike”) forman las espigas o espinas que sobresalen de la estructura esferoide del virus. Se organizan en grupos de tres. Bajo la ampliación del microscopio electrónico se muestran como espinas, dando al virus su apariencia característica y la denominación a esta familia de virus: coronavirus.



Las proteínas S se engarzan a la enzima humana «angiotensina-convertasa-2», muy abundante en las células epiteliales de los bronquios y bronquiolos del tracto respiratorio inferior. Destruyen el tejido pulmonar más profundo, siendo responsables de graves procesos neumónicos.

El gen vírico que codifica la proteína S tiene una breve mutación en su secuencia de nucleótidos (…ccucggcgggca…) que puede haber sido responsable de la gran infectividad en los humanos.

Una de las investigaciones más prometedoras es el diseño de vacunas con anticuerpos específicos contra estas proteínas S de la envoltura del virus, que constituyen los antígenos.




PROTEÍNA ORF3a [ORF, acrónimo de Open Reading Frame]


El genoma del SARS-Covid-19 codifica también un grupo de proteínas “accesorias” que facilitan la replicación del genoma viral. Esta proteína crea una evaginación en la membrana de la célula infectada que posibilita la fuga de las nuevas partículas víricas.

Así mismo, activa la respuesta inflamatoria del paciente, responsable de la sintomatología más grave y, en gran medida, de la mortalidad de esta neumonía vírica.

PROTEÍNA E (de “envoltura”)

La proteína E (de la envoltura) es una proteína estructural que permite formar la estructura semejante a una gota de aceite microscópica donde se ubican las nuevas partículas víricas formadas. También se adhiere (sin que se conozca la razón) a las proteínas que activan/desactivan (on/off) los genes de la propia célula para que ésta opere a favor del invasor (el virus).

PROTEÍNA M (de “membrana”)





Solo se sabe que forma parte de la envoltura del virus.




PROTEÍNA ORF6 (“bloqueante de señales”)


Esta proteína anula las señales de auxilio que la célula infectada lanza al sistema inmune para que acuda en su auxilio. ORF6 también se descubrió en otros virus, como el de la gripe  (influenza) y la poliomielitis.



PROTEÍNA ORF7a

Cuando los nuevos virus formados tratan de escapar de la célula infectada, ésta intenta atraparlos usando un tipo de proteínas denominadas genéricamente teterinas. A través de algún mecanismo ignorado, la proteína ORF7a reduce la cantidad de estas proteínas permitiendo que un mayor número de partículas escapen de la célula infectada.

La proteína ORF7a induce la apoptosis (suicidio) de la célula infectada.

PROTEÍNA ORF8



El gen que codifica esta proteína es específico de este coronavirus (SARS-Covid-19) ignorándose cuál es su función.




PROTEÍNA NUCLEOCÁPSIDE “N”



La proteína N es como la guardia pretoriana del virus; la primera línea de defensa de lo más importante que posee el virus, su ácido ribonucleico (ARN), donde se alberga en forma codificada no solo la información para su propia replicación, sino para la síntesis de todas las proteínas, que son como su propio ejército.

Estas proteínas N forman una larga espiral protegiendo el ARN en el hueco de la escalera que forman.




PROTEÍNAS ORF9b y ORF9c

De la ORF9b se sabe que bloquea el interferón, una vital proteína celular encargada de la lucha contra cualquier virus.

De la ORF9c, sencillamente se ignorada todo.

PROTEÍNA MISTERIOSA (ORF10)



Esta proteína sería como ¿el planeta? Plutón de nuestro Sistema Solar, lejano, único (no se ha observado en otros coronavirus) y misterioso. Al igual que sucede con Plutón, hay quien incluso cuestiona su existencia.


El genoma del coronavirus termina en forma misteriosa, con una secuencia repetitiva de nucleótidos de Adenina: aaaaaaaaaaaa, una especie de historia interminable.

Zaragoza, a 8 de abril de 2020

Dr. José Manuel López Tricas

Farmacéutico especialista Farmacia Hospitalaria

Farmacia Las Fuentes

Florentino Ballesteros, 11-13

50002 Zaragoza

Ċ
Lopeztricas Jose-Manuel,
8 abr. 2020 10:21
Comments